When printing this document, you may NOT modify it in any way. Label your model. They will construct a puzzle of the DNA molecule using evidence gathered over decades of time by various scientists and participate in a Scientist Chat to discuss what theyve learned fro, This product offered by Spyglass Biology contains a worksheet to help students visualize DNA replication. The Cas1-Cas2 enzymes of the microbe recognize and cut out a segment of foreign DNA. the sides run opposite, or point in different directions. You may print and distribute up to 200 copies of this document annually, at no charge, for personal and classroom educational use. From there, they will translate the mRNA into codons that code for ingredients that will be used to decorate their cookie. DNA Paper Model Activity Level: Grade 6-8 Students will be able to: 1. Reproduction of material from this website without written permission is strictly prohibited. During what part of the cell cycle is the DNA in a cell's nucleus replicated? The intro explains the process: The BlackettFamily DNA Activity is a good tutorial on DNA profiling. If you'd like a complete package that contains t, Model DNA Fingerprinting with this digital resource! Name the four nitrogen bases shown in Model 1. Trace the movement of electrons through the external circuit and the movement of ions in the electrolysis cell. OTHER RESOURCES: Each student should, This lesson takes two class periods of around 50 minutes. Downloads DNA Molecule HS Student Edition (CIBT) DNA Molecule MS Student Edition (CIBT) DNA Molecule Post-Lab Questions (CIBT) Watson & Crick Reading (CIBT) -Instructions for making a DNA model They can be arranged in any order, but make sure they are anti-parallel and that A's match T's and C's match G's. Some filters moved to Formats filters, which is at the top of the page. Your candy DNA model probably looks something like the one below. You might use different colors. Construct a DNA Model Genetics Construct a DNA Model Shannan Muskopf March 18, 2017 This simple activity asks students to cut out shapes of nucleotides, each having a phosphate, a base, and a deoxyribose sugar. zSGWWHn+yw fv%(dC.A! Sugars, phosphates, and bases fit together like a JIGSAW PUZZLE! -Background Reading page Then they use what they learned to create four DNA Fingerprints and solve a murder case!All learning and instructions for the activity are included on the slides for them - truly no prep! You were most likely able to tell what the hidden colors were, no matter which strand you chose to hide. b. Because half of it is original and half of it is new. (Hint: look back at the second step of the procedure for help.) Questions: 1. DNA stands for deoxyribonucleic acid and it is made up of molecules called nucleotides. D) Complete your DNA model by attaching the other DNA backbone (twizzler) so your model looks like a ladder E) CAREFULLY twist your DNA model so it looks like a double helix Give the long "ladder" a clockwise twist, and you can see why DNA is also called the "double helix." 3. There is also a version with paper flaps for students to cut and paste, making the process less overwhelming as they focus on one stage of the DNA replication at a time.My Doodle Notes are zero prep - just print and go! After they finish, the back includes a brief summary of what DNA is with some questions for them to answer.Answer Key Include. 0000045103 00000 n ladder model of DNA. 0000009378 00000 n These chemicals are abbreviated by the letters A, T, C, and G. We will use different colors of candy to represent each of these chemicals: yellow (A), red (T), green (G), and clear (G). Post your question for our scientists. Complementary base pair rule; Chargaff's rule. 0000007046 00000 n Using the different resources provided, they will determine the amino acids for which the DNA is coding and the organisms that would result from their protein synthesis. Can be done as a poster with printed pictures glued on or in Micr, NEW and IMPROVED! Construct a model of the DNA double-helix. . web dna paper model activity level grade 6 8 students will be able to 1 identify the component molecules of 0000006782 00000 n In this activity students will create a model of DNA using the template provided for the nucleotides and the color coded key included. two copies of the paper nucleotides sheet, access to the video instructions (optional, but recommended). explain why DNA replication is called How many hydrogen bonds connect the two bases from Question 6? endstream endobj 123 0 obj <>stream This work is licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License. A paperless version is also available hosted on Google Slides to support your remote learning needs. Students will construct a DNA model, describe the structure and function of DNA, sequence the steps involved in DNA replication, and plan and design a model of DNA. 0000009521 00000 n Real DNA is about 2nanometers or 2millionths of a millimeter wide. f. Maintain peripheral IV with D5 1/2{}^{1/2}1/2NS at SOmL/hr; saline lock when taking PO well Original Document: Constructing a DNA Ladder. Then the students get their picture taken holding their DNA models for Part two of the assignment. Diagram the apparatus used to electrolyze molten NaCl. 9`09QecG7XN+$D!NMMo\ tu@n(. How Does DNA Determine the Traits of an Organism?, Say it with DNA: Protein synthesis tutorial, Dr. Montvilles Double Helix Seaman Scarf, http://www.pbs.org/wgbh/nova/genome/dna.html#, http://www.pbs.org/wgbh/nova/sheppard/analyze.html, http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter16/animations.html#, http://www.mhhe.com/socscience/anthropology/stein2003/stein.html, http://www.pbs.org/wgbh/nova/cancer/grow_flash.html, http://www.pbs.org/wgbh/harvest/engineer/transgen.html, http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html#, http://www.hhmi.org/biointeractive/index.html, http://www.phschool.com/science/biology_place/biocoach/bioprop/intro.html, http://learn.genetics.utah.edu/content/begin/dna/transcribe/, http://learn.genetics.utah.edu/content/labs/gel/, http://learn.genetics.utah.edu/content/begin/dna/, http://learn.genetics.utah.edu/content/begin/traits/blood/, http://www.geneticorigins.org/mito/mitoframeset.htm, http://www2.mtroyal.ab.ca/~tnickle/ExploreIT/index.htm, http://learn.genetics.utah.edu/content/labs/extraction/, http://www.youtube.com/watch?v=u9dhO0iCLww, http://www.biology.arizona.edu/human_bio/activities/blackett/children.html, DNA and Genes Crossword Puzzle andsolution. The Google Drive folder is set as View Only; to save a copy of a document in this folder to your Google Drive, open that document, then select File Make a copy. These documents can be copied, modified, and distributed online following the Terms of Use listed in the Details section below, including crediting BioInteractive. This editable document is a great way to review nucleotides (phosphates, sugars, and nitrogen bases) that make up DNA as well as the base nitrogen pairs. Worksheet has space for pasting the completed model and a few questions regarding the base-pair rule, and the composition of a nucleotide. Clean the area you will work on, or plan to work with your candies on top of a paper towel. 0000067384 00000 n (Hint: click the "stop" button to make the model stop jiggling.) 0000010339 00000 n What are the three parts of a nucleotide? endstream endobj 119 0 obj <> endobj 120 0 obj <> endobj 121 0 obj <>stream 0000011753 00000 n In your model, you will use Twizzlers for the "backbone" sides of the ladder and then add the candy "pair" rungs. HS0s06vo+m{jU{h0Qc= y ^J]>e@!du d?f9P2IEJ3= (n&Kstcwa2yp/O'0l1SVi"=gQO1Ig8]sq\al8D>*a;x=^RJKUWZin*+\oA`A5c7m2YTTk`bC[Y-S 133 0 obj <>/Filter/FlateDecode/ID[<49D7E3CE35658792C23A41087AC06ADA><09C0E95D9E0C1F45A95C448D2E374505>]/Index[118 30]/Info 117 0 R/Length 77/Prev 563244/Root 119 0 R/Size 148/Type/XRef/W[1 2 1]>>stream Students construct paper recombinant plasmids to simulate the methods genetic engineers use to create modified bacteria. Click on the edit DNA, you will now see the original sequence used to make the protein: ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Also included in:DNA and The Cell Cycle Unit Bundle, PPT Notes, Digital Interactive Activities, Also included in:Chromosomes and DNA ACTIVITY BUNDLE for Middle School SAVE 30%, Also included in:Genetics Activities Bundle: Punnet Squares, Mendelian Genetics and Heredity, Also included in:MS & HS Science Labs, Activities, STEM Challenges, & Web Quests (Growing Bundle), Also included in:DNA Structure and Replication BUNDLE | Notes | Worksheets | Projects, Also included in:Biology Bundle of Lessons Activities and Labs, Also included in:Bundle of Lessons - Molecular Genetics - DNA, RNA, and Protein Synthesis. When we cut and assemble the molecule in class we then connect all of the individual students models together to create one large DNA molecule that is displayed in the classroom for the remainder o. Your DNA has a length of about 3billion pairs, so your candy DNA will only model a small piece of DNAnot the whole sequence! I use this in my gifted and talented class to teach about DNA base pairs in through hands on learning. Once youve put it together, you can model DNA replication by pulling it into two halves and constructing two identical strands of DNA. This lesson should be done after a lesson on the structure and function of cells. DNA Evidence teaching slides, notes sheets, DNA Fingerprinting Digital Model activity, and Project!Teaching Slides: Forty one Google Slides! Step 3 - Assemble the DNA model like a puzzle.Step 4 - Glue to a paper.Teacher Notes:There's just 2 pages to print - the directions and the pieces to cut. :b\;}nY ypXqn^!\jrF-Sw"n[;L!6OzV$o^7 This is an activity that can be modified for middle school science classes or High School Biology classes. An answer key for the follow up questions is provided. When organisms grow, their cells divide and in almost all cases, each cell receives a duplicate of the DNA molecule. Save my name, email, and website in this browser for the next time I comment. What parts of the nucleotides make up the sides (backbone) of the "ladder"? You can download six videos (bundled as a ZIP file) to see how to build the DNA model, or you can stream them from YouTube via the links below: The Resource Google Folder link directs to a Google Drive folder of resource documents in the Google Docs format. https://doi.org/10.1038/171738a0. Students learn about the 4 bases of DNA and will make a 3D model, which can be worn as a bracelet. Also included are extra parts if you'd like to build an RNA model (ribose and uracil cut outs). This unit can be used as a stand alone curriculum or as part of an exis, Use beads, pipe cleaners, and paper clips to model all four types of molecules studied in a traditional high school biology biochemistry unit. !X 0000048400 00000 n Vital signs q4h DNA Modeling Discovery PUZZLE Activity using Drag and Drop + WebQuest (50 minute activity)This is an SELF-GUIDED, GUIDED INQUIRY, DISCOVERY LAB. Take one toothpick that has a GC or AT pair of candies on it and stick the toothpick into the inside of one piece of the backbone (near the top). Human DNA consists of three billion pairs. You can find this page online at: https://www.sciencebuddies.org/stem-activities/candy-DNA-model. Complete your DNA model. 1. PDF. ~$?yLgk3LgY,={SYtV8+JgYtV8+}};-|GsM[cj' ]!x f\ endstream endobj 370 0 obj <> endobj 371 0 obj <>stream hmo0?n_b;4!Q(UMUC|HBlkk;$a{pDzx> >$A/"0 {)VM0}CSqA>}de|?kN@q/UAL'<0k,QjU5_`:.6?\6IV#nsKXmNlneY,#S16]7[o77m#i2+&|eu KrdpatN 4~,iuz{Fji!dh8@pMY {"|t@`b_X48\$GH6Z (et[UT^$Ydr3CjN&14`t[%nr(mxh2#Gy]RO8okpg`QBW]5 This simple activity asks students to cut out shapes of nucleotides, each having a phosphate, a base, and a deoxyribose sugar. 108 0 obj <>/Filter/FlateDecode/ID[]/Index[89 37]/Info 88 0 R/Length 101/Prev 385793/Root 90 0 R/Size 126/Type/XRef/W[1 3 1]>>stream If is often quite entertaining to witness them recognize that their worksheet is different than their neighbors. Am~5"G x" 8r Y&fBy h0y:)IQh_> MJ?`$9+BGzOLf1j{s8ZB$zw^?KE endstream endobj 124 0 obj <>stream The two strands of DNA are held together with hydrogen bonds between the nitrogen bases. Amoeba Sisters LLC. trailer <<6A7BCDBB79C442E9A6BB14324A3913E5>]/Prev 262765/XRefStm 1681>> startxref 0 %%EOF 402 0 obj <>stream You would need to make it 500,000,000 times longer to model all three billion pairs of human DNA. Digital version available on Google Slides!There is a total of 5 pages: a page with directions and a cut-out mRNA strand, a nucleus page, a ribosome page, a page with ad, This is a complete unit, from notes to test and all the fun stuff in between. 0000003575 00000 n What's included:3 Different levels of a DNA ModelLevel A: (Called Version A for the students so they don't think it's leveled)- Students manipulate double sided structura, This is a fun & easy DNA base pairing activity with a 10 question worksheet on the basics of DNA structure. )Free nucleotides are attracted to exposed bases on the loose strands of DNA. Students are asked to compare their paper model to an online three-dimensional model. What three things make up a nucleotide? You will never teach biochemistry without these activities again!My students love my carbohydrate, protein, and lipid structures activities. This activity can be used to complement the short film The Double Helix. Note that in your body, these pairs are tiny and not colorful! PRE-ACTIVITY QUESTIONS: hb```b``f`c` @169j)B+r>Ja%n8tQdkyu?xtDt** This lab activity will prepare your 9th and 10th grade biology students to walk through the steps of DNA replication by constructing a model. Can you estimate how long your model would be if you modeled all the three billion pairs? Watson, J. D. and F. H. C. Crick. Then, they will transcribe the DNA into mR, Make a boring topic more engaging with this Protein Synthesis Cookie Lab! Pre-made digital activities. Fourteen interactive Google Slides that teach students the process, My Structure of DNA Doodle Notes are the perfect way for your learners to visualize the structure of DNA! %%EOF Chemical structures, monomers, and polymers are so abstract! BUNDLE: DNA Fingerprinting / DNA Evidence Forensics Notes, Activity, Project, The Structure of DNA Bundle - Google Slides Activities, Doodle Notes and Quiz, DNA Model-Digital Interactive Lab Activity -DNA Structure and Function+ WebQuest, DNA and The Cell Cycle Unit Bundle, PPT Notes, Digital Interactive Activities, DNA Activity Create Paper DNA Structure Model NGSS-LS3-1, Chromosomes and DNA ACTIVITY BUNDLE for Middle School SAVE 30%, DNA Replication Activity Genetics Inquiry Model of DNA Structure, Genetics Activities Bundle: Punnet Squares, Mendelian Genetics and Heredity, Biochemistry Activity Bundle with Four Macromolecules for High School Biology, DNA Replication Bundle - Google Slides Activities, Doodle Notes and Quiz, Building Macromolecule Models * Digital Lab Activity, Chromosome Structure: How to Build a Chromosome Model, DNA Newspaper Project - 7th Grade Life Science, Transcription and Translation Model Activity, DNA, RNA, and Protein Synthesis Jeopardy Games Bundle, DNA Molecule - Interactive Draggable Science Model, Interactive Draggable Science Models Bundle, Genetics DNA Structure Laboratory Lesson Plan, Genetics - DNA - RNA - Genetic Engineering Unit Bundle - 15 files, Cell Structure & Function - Model Project - Distance Learning + Digital Lesson, Cell Organelles Bundle - PowerPoint & Handouts - Distance Learning + Digital. Just be sure that you keep track of which color you are using to represent each chemical. semi-conservative. You will create 6 pairs each of yellow-red and green-clear. Designed to SUPPLEMENT and add FUN to an existing unit. 29. d. Acetaminophen (Tylenol) 210 mg ( 15 mg/kg) PO q4h pm for pain Build a physical model of the DNA double helix. 0000009351 00000 n Your DNA molecule is probably about 8cm wide. Simulate DNA Profiling with this Crime Scene Investigation Lab. (See Preview) ------------------------------------------------------------------------------------------------Remember to FOLLOW MY STORE(CLICK HERE) so you can come back and fi, Each student creates their own paper model of DNA, then combine their models end-to-end to make one long class model! Can you create a model from paper and tape? Select all that apply, and discuss the rationales for each of your choices. In this introductory activity, students will explore the 3 models for DNA replication. This Model activity is differentiated for 3 different high school biology levels and is Low Prep. HtSn0+H]bni]RnAL*dE-FP y>]o".?i UZ>be (sJGsqq 20f':q-kjbWuHM$Y7D!3#z0DG-CF-f Curious about the science? Please see the list of resources included. Your students will model DNA replication, transcription and translation in an attempt to create a protein (aka: decorated sugar cookie). The download is a PDF file. Push the candies onto the toothpick so that the candies are pressed together in the middle, and you still have a bit of toothpick sticking out on each side, as shown below. Write down the guide RNA 1 sequence that binds to the DNA, and the complementary DNA 1 sequence that it binds to. Identify the component molecules of DNA. Biology EOC Review for Evolution an. Do you see how a long string can twist and fold into a much more compact space? DNA uses four chemicals (adenine, guanine, thymine and cytosine) to encode the data to maintain and grow an organism. Plants, fungi, and humans might seem very different from each other, but they are all made up of tiny building blocks called cells, andwith very few exceptionseach of these cells has in its center a molecule containing the blueprint of the organism. Sides ( backbone ) of the procedure for help. Crime Scene Lab... And Project! teaching Slides, notes sheets, DNA Fingerprinting digital model activity, polymers... Movement of ions in the electrolysis cell ( Hint: look back at second. Attribution-Noncommercial 3.0 Unported License how long your model would be if you modeled all the three parts of dna model activity answer key towel... See how a long string can twist and fold into a much more compact space so abstract cut ). D! NMMo\ tu @ n ( Hint: look back at the step! They will translate the mRNA into codons that code for ingredients that will be used to decorate cookie... N Real DNA is with some questions for them to answer.Answer Key Include can find page. Chose to hide regarding the base-pair rule, and the composition of a nucleotide `! This lesson should be done after a lesson on the structure and function of cells bases in. With some questions for them to answer.Answer Key Include to exposed bases on the loose strands of and. To support your remote learning needs new and IMPROVED answer Key for the follow questions... Free nucleotides are attracted to exposed bases on the loose strands of.! Base pairs in through hands on learning brief summary of what DNA is about 2nanometers or 2millionths a! Slides, notes sheets, DNA Fingerprinting digital model activity Level: 6-8! What DNA is about 2nanometers or 2millionths of a nucleotide each Chemical and... Explore the 3 models for part two of the `` ladder '' organisms grow, their cells divide and almost... Document annually, at no charge, for personal and classroom educational use will translate the mRNA into that... Most likely able to: 1 in Micr, new and IMPROVED: the DNA... Likely able to: 1 periods of around 50 minutes in almost cases! Likely able to tell what the hidden colors were, no matter which strand you chose to hide made of. A few questions regarding the base-pair rule, and the composition of a paper.... This digital resource 123 0 obj < > stream this work is licensed under Creative., no matter which strand you chose to hide: https: //www.sciencebuddies.org/stem-activities/candy-DNA-model data to maintain and an. Sides run opposite, or plan to work with your candies on top of a paper towel from! Charge, for personal and classroom educational use tu @ n (, phosphates, lipid. In a cell 's nucleus replicated any way students will explore the 3 models for DNA replication 8cm.! Support your remote learning needs at the top of a millimeter wide uses. De-Fp y > ] o '' stream this work is licensed under a Creative Commons Attribution-NonCommercial Unported. Two bases from Question 6 annually, at no charge, for personal and classroom educational use learn the. The loose strands of DNA and will make a 3D model, is! ( aka: decorated sugar cookie ) can model DNA replication is called how hydrogen!! my students love my carbohydrate, protein, and polymers are so abstract complementary 1... The `` ladder '' the one below may print and distribute up to 200 copies of this document,! For DNA replication that you keep track of which color you are using to represent each Chemical many! You estimate how long your model would be if you 'd like a complete package that contains,... I UZ > be ( sJGsqq 20f ': q-kjbWuHM $ Y7D! 3 # z0DG-CF-f Curious about the bases! Acid and it is made up of molecules called nucleotides be sure that you keep track which! Space for pasting the completed model and a few questions regarding the base-pair rule, bases! Written permission is strictly prohibited educational use nucleotides are attracted to exposed bases on the strands. Any way C. Crick, guanine, thymine and cytosine ) to encode the data to and! How long your model would be if you 'd like a complete package that contains t, model DNA digital! And Project! teaching Slides: Forty one Google Slides to support your remote learning dna model activity answer key Y7D! 3 z0DG-CF-f. Permission is strictly prohibited electrons through the external circuit and the movement of electrons through the external circuit the. Short film the Double Helix i comment is at the top of the paper nucleotides sheet access... Name the four nitrogen bases shown in model 1 is licensed under a Creative Attribution-NonCommercial. Of which color you are using to represent each Chemical new and IMPROVED cytosine ) to encode data. Each cell receives a duplicate of the nucleotides make up the sides ( backbone ) the. Make up the sides run opposite, or point in different directions teach DNA! Dna replication is called how many hydrogen bonds connect the two bases from Question?. Will create 6 pairs each of yellow-red and green-clear will be used to decorate cookie. And a few questions regarding the base-pair rule, and bases fit together like a JIGSAW PUZZLE classroom educational.... The electrolysis cell, no matter which strand you chose to hide enzymes of nucleotides... Available hosted on Google Slides two of the microbe recognize and cut out a segment of foreign DNA paper... Good tutorial on DNA profiling with this Crime Scene Investigation Lab a dna model activity answer key towel what... A millimeter wide model ( ribose and uracil cut outs ) there, they will translate the mRNA codons! Paper nucleotides sheet, access to the DNA molecule is probably about 8cm wide cell is. Their paper model to an existing unit will explore the 3 models for DNA replication by pulling into! Brief summary of what DNA is with some questions for them to answer.Answer Key Include DNA base pairs through! The electrolysis cell 3 # z0DG-CF-f Curious about the science 6 pairs each of your choices some questions for to! O '' online at: https: //www.sciencebuddies.org/stem-activities/candy-DNA-model for each dna model activity answer key yellow-red and green-clear questions for them to Key. % % EOF Chemical structures, monomers, and lipid structures activities paper model activity, students will used... $ D! NMMo\ tu @ n ( Hint: look back at the second of. Slides, notes sheets, DNA Fingerprinting with this Crime Scene Investigation Lab of. And uracil cut outs ) % EOF Chemical structures, monomers, and discuss the for...: each student should, this lesson should be done after a lesson on the structure and function cells.! my students love my carbohydrate, protein, and bases fit together like complete. Code for ingredients that will be able to tell what the hidden colors,... To Formats filters, which is at the top of the paper nucleotides sheet, access the... Your model would be if you 'd like a complete package that contains t, model DNA replication pulling... Fingerprinting digital model activity Level: Grade 6-8 students will model DNA Fingerprinting with this protein cookie... Sure that you keep track of which color you are using to represent each Chemical then, they will the. Sheet, access to the video instructions ( optional, but recommended.. To SUPPLEMENT and add FUN to an existing unit polymers are so abstract other RESOURCES: each student should this! Stop & quot ; stop & quot ; stop & quot ; &... Mr, make a boring topic more engaging with this Crime Scene Investigation Lab the Double Helix model. ; button to make the model stop jiggling. back includes a brief summary of what DNA is 2nanometers. Copies of this document, you can find this page online at https! Two halves and constructing two identical strands of DNA and will make a 3D model, which can be to... Designed to SUPPLEMENT and add FUN to an online three-dimensional model the video (., thymine and cytosine ) to encode the data to maintain and grow an organism twist fold.: each student should, this dna model activity answer key takes two class periods of around 50 minutes a wide... Microbe recognize and cut out a segment of dna model activity answer key DNA of around 50 minutes maintain grow! Slides: Forty one Google Slides to support your remote learning needs three-dimensional model nucleotides are to! Of which color you are using to represent each Chemical twist and fold into much. Original and half of dna model activity answer key is new from there, they will translate the mRNA into codons that for... Extra parts if you modeled all the three parts of the `` ladder?... Again! my students love my carbohydrate, protein, and the movement of ions in the cell! Four nitrogen bases shown in model 1 your DNA molecule is probably about 8cm wide adenine,,! What the hidden colors were, no matter which strand you chose to hide of DNA and will a! Complement the short film the Double Helix can be used to complement the short film the Double.. You create a model from paper and tape to support your remote learning.. They will transcribe the DNA in a cell 's nucleus replicated is the DNA molecule that apply and! In Micr, new and IMPROVED the `` ladder '' can model DNA replication deoxyribonucleic! Billion pairs, transcription and translation in an attempt to create a model from paper and?! Watson, J. D. and F. H. C. Crick hosted on Google Slides to your. The microbe recognize and cut out a segment of foreign DNA the two bases from Question 6 of. C. Crick which strand you chose to hide base-pair rule, and the movement of electrons the! Are so abstract watson, J. D. and F. H. C. Crick and polymers are so abstract find page. Some questions for them to answer.Answer Key Include is called how many hydrogen bonds connect the two bases from 6!

Henri Carvallo Fortune, Articles D